[home]
[inhoud site][Inhoud bovenbouw][practicum][links]

 

Samenvatting examenstof biologie VWO - vernieuwde tweede fase

Domein: C3

Levenscyclus van cellen

Alleen schoolexamen
Celdeling en celgroei

Je moet:

  • kunnen aangeven hoe deling, groei en ontwikkeling van cellen plaatsvinden en welke betekenis deze processen hebben voor het individu.
  • kunnen aangeven dat groei plaatsvindt door toename in aantal cellen, kanker beschrijven als een voorbeeld van ontregelde groei en weefselkweek als toename in aantal cellen onder kunstmatige omstandigheden.
  • Groei van weefsels
    • Door celdeling: mitose.
      Groei en diffenrentiatie onder invloed van:
      • inductie.
        • Invloed die cellen op elkaar uitoefenen.
      • hormonen.
  • Herstel van weefsels
    • Aangroei na een verwonding.
    • Kunstmatig: weefselkweek.
      Bijvoorbeeld:
      • voor afdekken van brandwonden.
  • Ontregelde groei
    • Kanker
      • Ontregeling van de het tempo van de celdeling: de cellen blijven doordelen.
      • Er ontstaan tumoren
    • Kwaadaardig
      • Tumor groeit in andere weefsels uit.
      • Extra gevaarlijk: uitzaaiingen.
        • Cellen uit tumor raken los en komen door bloed of lymfe in andere organen terech.

Weefselkweek

  • Weefsel buiten het lichaam laten groeien onder laboratorium omstandigheden.
    • Bij planten veel toegepast voor de vermeerdering.
    • Bij dieren toegepast bij huid
      • Verder nog in ontwikkeling/onderzoek.
Mitose en meiose

Je moet de stadia van mitose en meiose in een afbeelding kunnen herkennen en kunnen uitleggen wanneer en hoe verdubbeling en verdeling van het erfelijk materiaal (DNA) plaatsvindt en wanneer plasmagroei plaatsvindt; daarbij de fasen in de celcyclus kunnen noemen.

Gebruik Binas of Biodata

Celcylus

  • Interfase - tussen twee celdelingen in.
    • G1-fase
      • Toename hoeveelheid cytoplasma (plamagroei) .
        • Grootte van de cel neemt toe.
      • Aanmaak enzymen voor de replicatie van DNA.
    • S-fase
      • Maken van nieuw DNA (replicatie).
      • Van ieder chromosoom wordt een kopie gemaakt.
        • De twee strengen DNA (chromatiden) blijven met elkaar verbonden door het centromeer
    • G2-fase
      • Celorganellen worden bijgemaakt
      • Enzymen voor de mitose worden gemaakt .
  • M-fase
      • Mitose.
      • Celdeling (cytokinese).
        • Bij dierlijke cellen door insnoering van het celmembraan.
        • Bij plantencellen gevolgd door vorming van de celwand.
          • Eerst de middenlamel (van pectine) gevolgd door afzetting van cellulose.
  • Na de celdeling kunnen:
    • cellen in rust gaan - G0-fase.
    • gaan specialiseren.
    • opnieuw de celcyclus ingaan.

Mitose

  • Mitose
    • Voor groei en herstel.
    • Gevormde cellen krijgen het hetzelfde aantal chromosomen als moedercel (2n).
      2n --> 2n + 2n
    • Er ontstaan twee ddochtercellen.
  • Fasen
    • Interfase
    • Verdubbeling van de chromosomen (DNA-replicatie).
        • De nieuwe strengen worden chromatiden genoemd.
        • Blijven aan elkaar vastzitten bij het centromeer.
    • Profase
      • Chromosomen spiraliseren; worden korter en dikker.
        • Daardoor zichtbaar te maken onder een lichtmicroscoop.
      • Kernmembraan verdwijnt.
    • Metafase
      • Chromosomen rangschikken zich in het equatoriaal vlak (middenvlak) van de cel
        • Naast elkaar.
      • Spoeldraden (eiwitdraden) ontstaan vanuit de polen.
    • Anafase
      • Spoeldraden hechten aan centromeer.
      • Chromatiden worden uit elkaar getrokken.
        • Naar elke pool één chromatide.
          • Wordt nu weer chromosoom genoemd.
    • Telofase en cytokinese
      • Chromosomen despiraliseren.
      • Kernmembraan ontstaat.
      • Cytoplasma wordt gedeeld (cytokinese).

Meiose (reductiedeling)

  • Meiose 1 en 2
    • Gevormde cellen krijgen het halve aantal chromosomen (n).
    • Bij vorming geslachtscellen.
    • Er ontstaan vier dochtercellen.

  • Vergelijking mitose-meiose (eenvoudig)

    Afbeelding mitose-meiose
    • Meiose 1
      • Metafase: homologe (overeenkomstige) chromosomen rangschikken gaan in het equatotiaal vlak tegenover elkaar liggen.
      • Anafase: chromosomen worden uit elkaar getrokken.
        • Naar elke pool één chromosoom.
          • Bestaan nog uit twee chromatiden.
    • Meiose 2
      • Verloopt als mitose.
Celspecialisatie

Je moet:

  • kunnen uitleggen dat celspecialisatie ontstaat doordat bepaalde delen van chromosomen kunnen worden in- of uitgeschakeld; daarbij is er aandacht voor embryonale ontwikkeling, stamcelonderzoek, klonering en veroudering.
  • kunnen aangeven dat cellen invloed op elkaar uitoefenen
    in het bijzonder: inductie.

Celspecialisatie en differentiatie

  • Alle cellen in een organisme bevatten hetzelfde DNA.
    • Niet gespecialiseerde cellen heten stamcellen.
    • Uit stamcellen kunnen gespecialiseerde cellen ontstaan.
  • Celspecialisatie ontstaat doordat:
    • in een cel niet alle in een genen worden afgelezen.
      • Er zijn bepaalde genen ingeschakeld en andere juist weer uitgeschakeld.
      • Regeling activiteiten in de cel
        • Meestal door stoffen die van buiten de cel komen.
          • Hormonen (via het bloed).
          • Signaalstoffen van cellen uit de directe omgeving (inductie).
  • Celspecialisatie wordt gestuurd door regelgenen.
    • Regelgenen hebben ook invloed op elkaar.
  • De celspecialisatie begint tijdens de groei van een embryo.

Veroudering

  • Er lijkt verband te bestaan met schade aan het DNA.
    • Bij de celstofwisseling ontstaan stoffen (zuurstofradicalen) die daarbij betrokken zijn.
  • Beschadigd DNA wordt voortdurend gerepareerd, maar de reparatie is niet feilloos.
    • Hoe ouder men wordt, hoe meer schade aan het DNA.
Chromosomen

Je moet: kunnen uitleggen wat DNA is, wat een chromosoom is en hoe de erfelijke informatie hierin is opgeslagen
in het bijzonder:

  • genetische code;
  • introns en exons;
  • DNA-fingerprint.

Gebruik Binas of Biodata

Chromosomen

  • Bestaan uit DNA
    • Bij alle organismen op dezelfde manier gebouwd.
    • Alleen volgorde en aantal van de nucleotiden is anders.
      • Volgorde nucleotiden = genetische code
        • Genetische code --> erfelijke eigenschappen.
    • Bepaalt welke eiwitten door de ribsomen gemaakt worden.
    • Exons
      • Stukken die informatie voor eiwitten bevatten.
    • Introns
      • Stukken die geen informatie voor eiwitten bevatten.
  • Zitten in de kern (behalve bij bacteriën).
  • Komen meestal in paren voor.
    • Eén afkomstig van vader, één afkomstig van moeder.
    • 2n per kern = diploïd.
      • Bij mens 2n = 46
  • Bij geslachtscellen n (halve aantal) per kern = haploïd.

Genetische vingerafdruk (DNA fingerprint)

  • Basenvolgorde van (een deel van) het DNA wordt bepaald - DNA-sequencen.
    • Nodig kleine hoeveelheid cellen
      Bijvoorbeeld uit:
      • druppel bloed;
      • speeksel;
      • haar;
      • sperma.
  • Isoleren van het DNA uit de cellen.
  • Zuivering en vermeerdering van DNA via PCR methode (Polymerase Chain Reaction).
  • DNA wordt in in kleine stukjes verdeeld .
    • Met behulp van speciale enzymen.
      • Restrictie-enzymen.
  • De stukjes DNA worden gescheiden op grootte (gel electoforese).
  • Bij fingerprint wordt specifiek DNA bekeken:
    • het niet-coderend DNA (wordt ook wel junk-DNA genoemd).
      • Korte stukjes DNA met 2 tot 10 nucleotiden (short tandem repeats).
        • Stukjes bevatten zich herhalende code, bijvoorbeeld:
          AATCAATCAAATCAAATCAAT
    • Plaats in het DNA en de lengte van de stukjes verschillen per individu.
Mutaties
Je moet kunnen uitleggen dat een mutatie een verandering in erfelijke informatie is en dat mutaties kunnen worden veroorzaakt door straling, carcinogene stoffen ofwel spontaan voorkomen.

Mutatie

  • Verandering in het DNA.
  • Komen spontaan voor.
    • Bijvoorbeeld door fout bij de replicatie.
  • Kunnen veroorzaakt worden:
    • door straling.
      Bijvoorbeeld:
      • radioactieve straling;
      • röntgenstraling.
    • door bepaalde stoffen (mutagene stoffen).
      • Carcinogene stof
        • Mutatie kan kanker tot gevolg hebben.
      • Bijvoorbeeld:
        • teer (sigaretten);
        • asbest.
  • Kleine mutatie (puntmutatie)
    • Wordt ook SNP genoemd (Single Nucleotide Polymorphisms).
    • Verandering van één nucleotide.
      • Nucleotide is vervangen (substitutie).
      • Nucleotide is verwijderd (deletie).
      • Nucleotide is toegevoegd (suppletie).
    • Puntmutaties in het junk-DNA hebben weinig gevolgen voor het fenotype.
    • Puntmutaties in het coderend deel van het DNA kunnen wel grote gevolgen hebben.
      • Gevolgen van deletie en suppletie zijn over het algemeen groter dan die van substitutie.
  • Grote mutatie (chromosoommutatie)
    • Veranderingen in grotere delen van het chromosoom.
      • Chromosoom of deel vanchromosoom te veel (suppletie).
      • Chromosoom of deel vanchromosoom te weinig (deletie).
      • Deel van een chromosoom gaat vast zitten aan ander chromosoom (translocatie).
    • Chromosoommutaties zijn meestal schadelijk.
Genen
Je moet de begrippen allel en gen in verband kunnen brengen met de begrippen DNA en chromosoom.

Gen (genen)

  • Stukje van het DNA dat de informatie bevat voor de vorming van een eiwit.
    • Eiwitten zijn bouwstoffen van de cel.
    • Een groot deel van de eiwitten werkt als enzym (reactieversnellers).
    • Regelt via enzymen de processen in de cel.
      • Er wordt kopie gemaakt van het gen.
      • Kopie is RNA.
      • RNA gaat door de kernmembraan naar ribosoom in cytoplasma.
      • Ribosoom leest RNA af.
        • Aminozuren worden in bepaalde volgorde aan elkaar gekoppeld --> eiwit
  • Allel (allelen)
    • Bepaald gen kan verschillende vormen hebben.
    • In cel twee chromosomen met genen voor dezelfde erfelijke eigenschappen.
      • Homologe chromosomen.
        • Eén afkomstig van moeder, één van vader.
      • Genen op die chromosomen kunnen verschillende van samenstelling zijn.
      • Er kunnen andere de nucleotiden in zitten.
    • Een allel is dus een variant van een gen.
Ontwikkelingen
Je moet een mening kunnen formuleren en beargumenteren over het gebruik van, cellen, delen van cellen, stoffen van cellen, en organismen in de moderne biotechnologie.

Stamcelonderzoek

  • Stamcel is een cel die nog ongedifferentieerd is.
    • Heeft delingsvermogen.
    • Kan nog uitgroeien tot allerlei typen cellen.
  • Stamcellen kunnen worden gekweekt.
    • Afkomstig van:
      • patiënt zelf.
      • van donor.
  • Worden als stamcel in het lichaam (terug)gebracht.
    Voorbeelden van mogelijke toepassingen:
    • stamcellen uit het oog voor herstel van het hoornvlies.
    • stamcellen uit beenmerg om door chemotherapie beschadigde cellen te vervangen.
  • Onderzoek kan met:
    • embryonale stamcellen (afkomstig van materiaal dat overblijft na IVF).
    • volwassen stamcellen.
      Bijvoorbeeld:
      • beenmergcellen.
      • cellen uit navelstreng bloed.
  • Behandeling (stamceltransplantaties) mag alleen met volwassen stamcellen.

© scholte/marree 2009